Mingling sequences in Fasta and Fastq formats ~ Plus other #bioinformatics tips for NGS analyses from the command line
Joined November 2021
- Tweets183
- Following46
- Followers210
- Likes367
There is a new and faster way to install the main SeqFu binary:
curl -fsSL "telatin.github.io/seqfu2/ins…" | sh
of course, bioconda is still an easy way to get it.
SeqFu is a swiss-army knife for FASTA and FASTQ manipulation and can be a very handy tool for pipelines!
1/2
You can learn more about SeqFu in the website:
Learn more: github.com/telatin/seqfu2
2/2
Would you like to inspect FASTQ files from your terminal?
`seqfu less` can do that! You can scroll, search for motives and see intuitive colored bars representing quality values.
Check it out here: telatin.github.io/seqfu2/too… [1/2]
SeqFu has a new website!
We tried to make it nicer, but also introduced new in-browser applets.
Try these two:
- 📊 STATS to calculate N50, plots, and more for one or more files
- 🔍 LESS to have a small preview of FASTQ files, with oligo match ..
telatin.github.io/seqfu2/
SeqFu 1.22.0 is out, with some minor improvements and updates.
It's codenamed #EBAME9 because it features a new `--anvio` mode in "seqfu cat"
github.com/telatin/seqfu2/re…
SeqKit 2 is now described in a new paper!
It's great to see this great program growing. Inspiring! onlinelibrary.wiley.com/doi/…
Did you know that fu-index allows you to extract lane and run information from Illumina datasets?
This can be useful when splitying by run (e.g. when running DADA2 or prevent batch effect)
telatin.github.io/seqfu2/uti…
ALT screenshot of fu-index
Microsoft wants to buy us, but then they would make `SeqFu (work or school)` and `SeqFu (new)` available through their app store...
SeqFu toolkit retweeted
Complain all you want about peer review @FrontiersIn, but its current manifestation is the logical extension of a toxic, dysfunctional and irrational publishing culture that treats papers as currency and continues to propagate the lie that "peer reviewed" means "valid".
🥖 Freshly baked: Fasten by @lskatz was just published in @JOSS_TheOJ.
Of course, it's a fast FASTQ manipulation toolkit, written in Rust.
UNIX pipes provided. Bring your own dataset :)
SeqFu toolkit retweeted
Metagenome taxonomy profilers usually ignore unknown species. SingleM is an accurate profiler which doesn't, even detecting phyla with no MAGs.
We applied it to 250,000 metagenomes- in environmental samples 75% lack a genome/MAG (abundance-weighted). A 🧵biorxiv.org/content/10.1101/…
Thanks!
>1_1 frame=+0 start=0 tot=3
MERRYCHRISTMASANDAHAPPYNEWYEAR
with SeqFu ORF telatin.github.io/seqfu2/uti…
ATGGAGAGGAGGTACTGCCACAGGATCAGCACCATGGCCAGCGCCAACGACGCCCACGCCCCCCCCTACAACGAGTGGTACGAGGCCAGG from everyone at
@ensembl
Hey #Miniconda users, `conda-libmamaba-solver` is default solver since 23.10, so stop installing mamba
(Or use #micromamba straight away! 😜)
Have a nice weekend, folks!
Keep your #HPC clusters busy over the weekend with your #bioinformatics analyses 🙃
Thanks for the GitHub stars, I just realise they are slowly growing.
Can we hit the 128 🌟 (2^7)?
Thanks :)
SeqFu toolkit retweeted
A new #SeqFu release directly from the Gambia!
Bugfix, slight improvement to fu-orf (1.20.1)
And moved the building stack to nim 2.0
Unfortunately, bioconda recipe won't work on macOS for the latest version... you can get up to 1.20 on mac until this gets fixed – at Gambia
Also this year, we had the opportunity to share some #SeqFu stickers at #EBAME8 with @EvelienAdri, @HannahVPye and @telatin.
Every single sticker is honoured...
ALT Beach near Brest, France